Transcription/Translation Performance Task

Are you ready to decode DNA?

Background

DNA is considered to be the heart of biology. Your understanding of evolution will depend very heavily on your ability to explain how a change in DNA can lead to a change in a protein which can then lead to a change in the organism itself, possibly impacting the future of the population. Today you will analyze a real-world example of a genetic disorder caused by a change in the DNA.     

Instructions

You will assume the role of a genetic researcher studying a disorder called Sickle Cell Anemia (SCA). SCA is caused by a gene mutation in the DNA coding for a protein called hemoglobin found in red blood cells and used to carry oxygen throughout the body. This mutation changes the instructions for hemoglobin, and as a result the protein does not form correctly. Red blood cells must travel through very narrow capillaries in the circulatory system to transport oxygen, so their normal round shape (see figure below) helps make this passage easier. SCA causes the hemoglobin to alter the cell's shape and form a crescent instead of a circle. The pointed crescent shape gets stuck in the narrow capillaries, preventing oxygen from traveling to the cells and causing frequent painful cramps and cell damage in afflicted individuals. You have identified two possible gene sequences and must use your analysis of the SCA hemoglobin protein to determine which sequence is the normal DNA and which sequence is mutated. Follow the instructions below to guide you in performing this task. 

Normal vs Sickle Cells

(Figure showing normal vs sickle cells obtained from https://commons.wikimedia.org/wiki/File:Sickle_cell_anemia.jpg)

Part 1 - Transcription and Translation

Use your knowledge of transcription and translation to determine the amino acid sequence that would be created from each of the following DNA sequences. (Reminder: Translation begins at the start codon!)

DNA sequence #1:  GTTCTACCACGTAGACTGAGGACTCACTAAA

mRNA sequence #1: 

Amino Acid sequence #1: 

DNA sequence #2:  

GTTCTACCACGTAGACTGAGGACACACTAAA

mRNA sequence #2: 

Amino Acid sequence #2: 

Part 2 - Identify the Mutation

Analysis of hemoglobin proteins obtained from an individual with SCA has been shown to contain the following amino acid sequence. Using the information from part 1, identify which of the above DNA sequences is normal and which is mutated, justifying your choice.

Sickle Cell Hemoglobin Analysis: Met – Val – His – Leu – Thr – Pro – Val

Part 3 - Find a Cure

Use the information from parts 1 and 2 as well as the internet or your notes to help you answer the following questions. 

1. What type of mutation causes Sickle Cell Anemia? 

2. How is the mutated protein different from the original? Bonus points if you can research and explain the effect on the protein in biochemical terms! How is the substituted amino acid chemically different from the original? Hint: check out how the changed amino acid(s) behave(s) in water! 

3. What is the effect on homeostasis of the afflicted person? i.e. – what are the symptoms of the disease?

4. What is the current treatment for Sickle Cell Anemia? 

5. Using your imagination, what would be the only way to totally cure Sickle Cell Anemia? Bonus points if you can research and name the biotechnology most likely to accomplish this in the future!       

Rubric and Key

Rubric

Key - Part 1

DNA sequence #1:     GTTCTACCACGTAGACTGAGGACTCACTAAA

mRNA sequence #1: CAAGAUGGUGCAUCUGACUCCUGAGUGAUUU

Amino Acid sequence #1:  MET - VAL - HIS - LEU - THR - PRO - GLU ACID - STOP

DNA sequence #2:  GTTCTACCACGTAGACTGAGGACACACTAAA

mRNA sequence #2: 

CAAGAUGGUGCAUCUGACUCCUGUGUGAUUU

Amino Acid sequence #2: MET - VAL - HIS - LEU - THR - PRO - VAL - STOP

Key - Part 2

Sequence 2 is mutated because it matches the Sickle Cell analysis. Sequence 1 must be the normal protein because it does not match the analysis. 

Key - Part 3

1. Point (missense) gene mutation

2. The mutation has a valine where there should be a glutamic acid. (Bonus points - valine is hydrophobic and therefore behaves differently in water than the hydrophilic glutamic acid.)

3. Severe cramping, organ damage, anemia, strokes, cell death, etc

4. Medications to ease symptoms, monthly blood transfusions to infuse the patient with healthy donor cells, etc. 

5. Repair the DNA (Bonus points if they can link this idea to gene therapy, genetic modification, and/or restriction enzymes)